Multiplex PCR followed by restriction length polymorphism analysis for the subtyping of bovine herpesvirus 5 isolates.

Maidana et ah BMC Veterinary Research 2013, 9:1 1 1
http://www.biomedcentral.eom/1746-6148/9/1 1 1

Veterinary Research

RESEARCH ARTICLE Open Access

Multiplex PCR followed by restriction length
polymorphism analysis for the subtyping of
bovine herpesvirus 5 isolates

Silvina Soledad Maidana 1,2 , Cintia Debora Morano 1 , Daniela Cianfrini 4 , Fabricio Souza Campos 5 ,
Paulo Michel Roehe 5 , Bianca Siedler 6 , Gabriel De Stefano 1 , Axel Mauroy 7 , Etienne Thiry 7 *
and Sonia Alejandra Romera 1,2,3

Abstract

Background: Several types and subtypes of bovine herpesviruses 1 and 5 (BoHV-1 and BoHV-5) have been
associated to different clinical conditions of cattle, making type/subtype differentiation essential to understand the
pathogenesis and epidemiology of BoHV infections. BoHV-5 subtyping is currently carried out by BstEW restriction
enzyme analysis (REA) of the complete virus genome. This method allowed the description of three subtypes, one
of which is the most widespread while the remaining two have so far only been found in South America. The
present work describes a multiplex PCR followed by REA for BoHV-5 subtyping.

Results: The method consists in the simultaneous amplification of glycoprotein B and UL54 gene fragments of 534 and
669 base pairs (bp), respectively, BstEW digestion of amplicons, separation of products in 1% agarose gels, and analysis of
fragment length polymorphims. The multiplex PCR detected up to 227 BoHV-5 genome copies and 9.2 x 10 5 BoHV-5
genome copies when DNA was extracted from purified virus or infected tissue homogenates, respectively. The
applicability of multiplex PCR-REA was demonstrated on 3 BoHV-5 reference strains. In addition, subtyping of two new
isolates and seventeen previously reported ones (17 BHV-5a and 2 BHV-5b) by this method gave coincident results with
those obtained with the classic BstEW REA assay.

Conclusions: Multiplex PCR-REA provides a new tool for the fast and simple diagnosis and subtyping of BoHV-5.

Background

Bovine herpesvirus 5 (BoHV- 5) is an alphaherpesvirus re-
sponsible for meningoencephalitis in young cattle, and is
antigenically and genetically closely related to bovine her-
pesvirus 1 (BoHV-1) [1]. The origin and geographic distri-
bution of BoHV-5 infections are largely unknown, mainly
due to serological cross-reactivity with BoHV-1 [2]. Spor-
adic cases of meningoencephalitis by BoHV-5 have been
reported in Australia [3], USA [4], Italy [5] and Hungary
[6]. In contrast, BoHV-5 infection and disease appear to be
more frequent in Argentina and Brazil, where numerous
outbreaks were described in the last decades [7-11]. The
rare occurrence of BoHV-5 neurological disease in areas

* Correspondence: etienne.thiry@ulg.acbe

'Veterinary Virology and Animal Viral Diseases, Department of Infectious and
Parasitic Diseases Faculty of Veterinary Medicine, University of Liege, Liege,
Belgium

Full list of author information is available at the end of the article

where BoHV-1 infection is endemic may be explained by
cross-protection induced by natural infection or vaccin-
ation [12-14].

BoHV-5 infection induces either a subclinical infection
or disease of moderate severity in adult cattle [15] and le-
thal encephalitis in young animals [6,7,16].

Virological assays are very accurate tools to specifically
diagnose BoHV-5 infections. Virus isolation in cell culture
can be performed from fresh or frozen nasal secretions,
semen or post mortem samples [1]. However, in light of
recent reports of bovine herpesviruses isolated from dif-
ferent samples, and responsible for both symptomatic and
asymptomatic infections [11,17,18], classical diagnostic
methods are not sufficient for a fast and easy identification
and subtyping of the infectious virus.

Several assays are available to differentiate BoHV-5 from
BoHV-1, including immunoassays using monoclonal anti-
bodies [19-21], PCR followed by REA [22], nested PCR

O© 201 3 Maidana et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
BlOlVICCl Central Commons Attribution License (httpy/creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.

Maidana et ah BMC Veterinary Research 2013, 9:1 1 1
http://www.biomedcentral.eom/1746-6148/9/1 1 1

Page 2 of 7

[13], multiplex PCR [23-25], random amplified poly-
morphic DNA (RAPD) [26], and multiple PCR sequencing
assays [27]. Moreover, BstEll restriction enzyme analysis
(REA) of the complete virus genome can differentiate be-
tween BoHV-5 subtypes; but the technique is laborious
and needs substantial amounts and quality of viral DNA
[28,29]. In addition, a recently described UL27PCR-REA
[11] assay has been shown to differentiate between BoHV-
5 subtypes a and b but it cannot differentiate the subtype c.

We here describe a molecular technique that allows the
detection and differentiation of all BoHV-5 subtypes. We
also report the identification and characterization of two
new BoHV-5 isolates from the Argentinean Provinces of
Buenos Aires and Chaco. One of them corresponds to a
symptomatic case obtained during an outbreak of neuro-
logical disease in a cattle herd, while the other corresponds
to a non symptomatic case isolated from a bovine semen
sample.

This development could be epidemiologically relevant in
areas where BoHV-5 infection is endemic, and provides a
new tool for the fast diagnosis and subtyping of BoHV-5.

Results

Differential PCR for BoHVI and BoHV5

The new virus isolates 674 and 2010 were tested by
multiplex PCR [24] and shown to be BoHV-5.

REA

One of the new field isolates (2010) showed a BstEll REA
pattern similar to reference strain N569, which is the BoHV-
5a prototype, and the other (674) showed a pattern similar
to reference strain A663, the BoHV-5b prototype (Figure 1).
A double 3 kb band was observed in the first case, but it fell
outside of the area used for subtype classification.

Determination of a differential restriction site for a and c
subtypes

Fragments (500 bp) of the UL54 gene from BoHV-5 sub-
types a (N569), b (A663 reference strain) and c (IS097/89)
were sequenced. Sequence alignment revealed a point muta-
tion (G to A) in the BstEll restriction site for subtype c
(1879 nt position, NC_005261.2), as compared to subtype a,
responsible for the variation in the REA pattern (Figure 2).
This point mutation did not result in an amino acid change.

Multiplex UL27/UL54 PCR and BstEll restriction analysis

In the new assay developed in this work, the differential
expected band pattern for each of the three BoHV-5 sub-
types after multiplex PCR-REA is shown in Figure 3. The
PCR products after digestion showed different cleaved com-
binations. The band of 669 bp is cleaved into two bands of
408 and 248 bp. Moreover the band of 534 bp is cleaved
into two bands of 382 and 152 bp. Isolates 674 and 2010
showed band patterns similar to BoHV-5b and BoHV-5a

1 2 3 4 5 6 7

Figure 1 Subtyping of new BoHV-5 isolates from Argentina.

Bstfl restriction endonuclease profiles of isolates 674 and 2010
(lanes 5 and 6) and N569, A663 and IS097/89 reference strains (lanes
2, 3 and 4), M: DNA size marker (lambda Hind III, Invitrogen).

prototypes, respectively (Figure 4). In addition, when DNA
of the three different BoHV-1 subtypes was used as tem-
plate, amplification products could not be digested by BstEll
(data not shown).

Sensitivity of the test

The multiplex PCR assay detected as few as 305 to 455
ng/ul of purified BoHV-5 DNA or approximately 203 to
303 genome copies. In the case of DNA extracted from
infected tissue homogenates the assay detected down to
9.200 genome copies.

Discussion

In countries like Argentina and Brazil where circulation of
BoHV-5 is high and viral subtypes not described elsewhere
in the world occur, there is a need for rapid and easy diag-
nostic tools which allow the classification of viral species
and subtypes. In this work, a new multiplex PCR-REA that
easily identifies all BoHV-5 subtypes was developed and im-
proves previous assay reported by Claus [24]. The latter can
be used as a confirmatory test for the detection of this virus
and only allows species differentiation between BoHV-1 and
BoHV-5, while our multiplex PCR - REA permits simultan-
eous subtyping of the isolates. This method was applied to
17 previously characterized virus isolates [11] and 2 newly

Maidana et ah BMC Veterinary Research 2013, 9:1 1 1
http://www.biomedcentral.eom/1746-6148/9/1 1 1

Page 3 of 7

1810 1820 1830

.... | .... | .... | .... | .... | .... |
NC_005261.2 CTTGTGCGTGTCCAAGGCGTCGATGAAGCC

BoHV5b

BoHV5c C

1840 1850 1860

.... | .... | .... | .... | .... | .... |
NX_005261.2 CGCCACGCAAGCCCCAGGGATGTACTCCTC

BoHVSb

BoHVSc

1890
I

1870 1880
.... | .... | .... | . .
NC_005261.2 CAACGGCGCGTCGCCCACfCGI t AC t 1 C ( G A

BoHVSb

BoHVSc

1910

1920

1900

.... | .... | .... | .... | .... | .... |
NC 005261.2 C AGCGGC ACGCGCTCTGCGCCGGAGCGC AC

BoHVSb

BoHV5c

1930

1940

1950

NC 005261.2 CGCGCGGCTGAGGCGCGCCAGCATCACGAA

BoHVSb

BoHVSc

I960 1970 1980

.... | .... | .... | .... | .... | .... |
NC_005261.2 CATGTACGAGGCTGGGCAGGTGGCGAGGCT

BoHV5b

BoHV5c

1990 2000 2010

.... | .... | .... | .... | .... | .... |
NC_005261.2 TAGCCGCCGCGCGGCGCAGAGCTCCTCGAG

BoHVSb

BoHV5c

Figure 2 Multiple nucleotide alignment of UL54 sequences from BoHV-5a (Genbank accession numbers NC_005261 .2), BoHV-5b (A663)
and BoHV-5c (IS097/89). Dots indicate conserved nucleotides, flstfll restriction site has been boxed.

UNDIGESTED DIGESTED
PCR PRODUCTS PCR PRODUCTS

Figure 3 Scheme expected restrictions patterns with BsfEII of multiplex PCR product of BoHV-5 subtypes M: molecular weight marker.

The products of the undigested multiplex PCR showed two bands of 669 and 534 bp. The two bands, only the 669 bp one and only the 534 bp
one are digested in subtypes a, b and c respectively.

Maidana et ah BMC Veterinary Research 2013, 9:1 1 1
http://www.biomedcentral.eom/1746-6148/9/1 1 1

Page 4 of 7

Subt.

Subt.
b

Subt.

REPRESENTATIVE FIELD ISOLATES

UD D UD D UD D UD D MWUD D UD D UD D UD D UD D

UD D UD D MW

Neg. N569 A663 IS097/89 674 2010

Ctrol

Figure 4 Multiplex PCR-REA applied PCR amplicons before and after digestion with BsfEII restrictions enzyme of the Argentine BoHV-5
representative isolates and reference strains. The lanes corresponding to the most recent isolates are marked. Ud: undigested; D: digested;
Subt: subtype; Neg.: Control Negative; Ref: reference strain. M: 1 Kb plus DNA size marker.

identified ones. Results were identical to those obtained with
the classical BoHV-5 subtyping technique (BstEU restriction
profile of the entire genome). When different BoHV-1 sub-
types were used as template for this multiplex PCR-REA,
fragments of different molecular weight, as compared to
BoHV-5, were obtained. Multiplex PCR-REA is more sensi-
tive, faster, less laborious and more economical than the
traditional whole genome restriction analysis, and can detect
DNA both from purified virus and tissues.

The protocol uses two pairs of primers for the simultan-
eous amplification of UL27 and UL54 segments. Due to the
molecular weight differences in the amplified fragments
after digestion, it is possible to clearly distinguish the char-
acteristic bands of each subtype by visual analysis of agarose
gels. Amplicon sequencing allowed to find the point muta-
tion responsible for the change on the restriction site of the
enzyme BstEll and thus, for the different profiles obtained
for a and c subtypes (G-1879 nt-A genbank accession num-
ber: NC_005261.2). This mutation was, until now, only ob-
served in subtype c (IS097/89) strain, isolated in Brazil
[29]. We showed here the analysis of one out of two
BoHV-5c subtypes reported until now in the world.

The method showed a detection sensitivity of 227 BoHV-5
genome copies of purified virus and 9.2 x 10 s BoHV-5 gen-
ome copies from tissue samples.

Nineteen BoHV-5 field isolates, including two newly
identified ones, were subtyped using the described method.
One of the two new isolates included in this work was iso-
lated from cryopreserved bovine semen. To our knowledge,
this is the first report of BoHV-5 virus identification from
semen in Argentina. This sample was classified as subtype
b by multiplex PCR-REA, constituting the last and one of
the three BoHV-5b isolates characterized so far. Although
no virulence differences between a and b subtypes have
been found [30], subtype identification is relevant to under-
stand virus genetic variability and contribute to molecular
epidemiology studies. Noteworthy, the virally contaminated
semen was harvested from an apparently healthy bull. This

finding agrees with similar results obtained in Brazil and
Australia [17,18]. Whether BoHV-5 transmitted to a cow
via artificial insemination (AI) can cause neurological disor-
ders in the recipient remains to be determined. Given the
widespread use of AI to diversify cattle stocks, detection of
animal viruses in semen, either by virus isolation or PCR, is
crucial. In conclusion, the multiplex PCR-REA described in
this work provides a new tool for the fast diagnosis and
subtyping of BoHV-5. This development can aid in the un-
derstanding and control of these detrimental bovine viral
infections.

Conclusion

Fast and easy tools for the characterization of BoHV-5 viral
isolates are required. Since, due to technical limitations, se-
quencing is not an option, the multiplex PCR - REA sys-
tem described in this work provides an attractive tool for
the improved control of BoHV-5 viral infections.

Methods

Cell culture and virus isolates

During a routine health test, a BoHV-5-positive semen
sample was obtained in 2010 from a clinically healthy bo-
vine from the Argentinean Province of Chaco (isolate 674).
The semen sample was diluted 1:6 in fetal calf serum (FCS)
and inoculated onto bovine testis cells in minimal essential
medium (MEM) containing 10% FCS. Cells were incubated
at 37°C in a 5% CO2 atmosphere, and daily checked for cy-
topathic effects (CPE). The second characterized isolate
was obtained from an animal of about 4 months of age at
weaning stage from the Argentine Province of Buenos
Aires isolated in 2010 (isolate 2010). A typical outbreak
with nervous symptoms and 20% lethality occurred in the
50-catle herd to which this calf belonged. One gram of
brain tissue of this animal was homogenized, suspended in
MEM containing 10% FCS and clarified at 11 000 x g for
20 min at 4°C. Then, half of the supernatant was inocu-
lated into bovine testis cells in MEM containing 10% FCS

Maidana et ah BMC Veterinary Research 2013, 9:1 1 1
http://www.biomedcentral.eom/1746-6148/9/1 1 1

Page 5 of 7

and the other half was used for DNA extraction. Isolates
674 and 2010 originated therefore from samples sent to
diagnostic laboratories for routine testing and are not
subjected to a prior approval by the animal welfare com-
mittee. Three BoHV-5 reference strains were used as sub-
type controls: N569 (BoHV-5a), A663 (BoHV-5b) and ISO
97/87 (BoHV-5c). After standardization of the multiplex
PCR assay, the method was tested on the two new isolates
mentioned above and 17 previously characterized BoHV-5
(16 BoHV-5a and 1 BoHV-5b) field isolates [11].

DNA extraction for PCR

The infected cell culture supernatant from semen and the
supernatant of homogenized tissue of the BoHV-5 positive
sample were subjected to DNA extraction using QIAamp
DNA Mini kit (Qiagen, Hilden, Germany) according to
the manufacturer's protocol. Purified DNA was stored at -
20°C until testing. DNA concentration was deduced from
absorbance measured in a spectrophotometer.

Differential PCR for BoHV-1 and BoHV-5

To identify the viral species of isolates 674 and 2010, the
multiplex PCR designed by Claus and collaborators [24]
was carried out. Amplification products were of 354 bp and
159 bp for BoHV-1 and BoHV-5, respectively. Products
were analyzed on 1% agarose gel electrophoresis, stained
with ethidium bromide (0.5 (ig/ml) in TBE buffer (89 mM
Tris, 89 mM boric acid, 2 mM EDTA, pH8.4), and visual-
ized under UV light.

Classic subtyping of BoHV-5 by restriction endonuclease
analysis (REA)

Field isolates 674 and 2010 were inoculated in tissue culture
flaks (175 cm ) with nearly confluent, overnight grown
MDBK (Madin Darby bovine kidney) monolayers, at a
multiplicity of infection of 0.1, and incubated at 37°C and
5% CO2. Post infection cultures were frozen at -80°C. After
two successive rounds of freezing and thawing, clarification
was carried out at 3000 rpm for 20 min at 4°C. Purification
and extraction of viral DNA was performed as detailed by
Maidana et al. [11].

Four ug of viral DNA from each reference strain and field
isolate (2010 and 674) were incubated overnight with BstEH
restriction enzyme (1U) under the conditions recommended
by the manufacturer (Promega, Wisconsin, USA). Digestion
products were separated overnight by electrophoresis on
0.7% agarose gels at 50 V using TBE buffer. Gels were
stained with ethidium bromide and photographed under
UV light.

Identification of differential restriction sites between
subtype a and c

Although differential PCRs to discriminate between BoHV-
1 and BoHV-5, or between BoHV5a and b subtypes have

been developed [11,24], subtype c is still indistinguishable
by these techniques. In silico analysis showed that a site in-
cluded in the open reading frame of the UL54 gene serves
to differentiate subtype c from the other two. Primers were
designed based on the published sequence of BoHV-5
(Genbank accession number: NC_005261.2) (UL54F: TAT-
AAC-CCC-CTC-AAC-AAA-AT (nt 1631 to 1650) and
UL54R: TCT-GCG-AGT-ACC-AGG-TGC-CG nt 2280 to
2300). DNA sequence analysis to locate polymorphic regions
within the UL54 target gene was performed using Vector
NTI Suite version 8.0 (Invitrogen, Merelbeke, Belgium).

The assay was performed with purified DNA from strains
of different subtypes

Amplification was carried out in a 50 ul reaction mix
containing 5 ng of template DNA, Taq DNA polymerase
buffer (NEB, Ipswich, MA, USA), 2 mM MgCl 2 , 6%
DMSO, 200 uM dNTPs, 0.3 uM of both forward and re-
verse primers and 1U Taq DNA polymerase (NEB).
Annealing temperatures were optimized for each primer
pair. The PCR program consisted of 10 min at 96°C,
followed by 35 cycles of 1 min at 96°C; 1 min at 58°C and
1 min at 72°C with a final extension step of 10 min at
72°CThe resulting products were separated by electro-
phoresis in 1% agarose gels and visualized under UV light
after ethidium bromide staining. Amplified products were
purified using Illustra GFX'" PCR, DNA and gel band puri-
fication kit (GE Healthcare, Diegem, Belgium). The quality
of all DNA preparations was evaluated by agarose gel elec-
trophoresis. Sequencing reactions were performed with
BigDye Terminator v3.0 kit (Applied Biosystems, Lennik,
Belgium) and analyzed in an ABI Prism 3730 DNA
Analyzer (Applied Biosystems).

Each PCR product of reference strains was sequenced
twice in both directions using forward and reverse primers.
Nucleotide and predicted amino acid sequences were
edited; aligned and analyzed with BioEdit version 7.0.5.3
[31] to determine single nucleotide polymorphisms at
BstEH restriction sites.

Multiplex PCR-REA assay for BoHV-5 subtyping

UL27 PCR assay [11] was modified for easy discrimination
between three BoHV-5 subtypes. The above described
UL54 primers that amplify a fragment of 669 bp were in-
corporated into the UL27 PCR [11]. As template, total gen-
omic material of the three subtypes of BoHV-5 was used.
The expected results of this multiplex PCR are two bands
of 669 bp and 534 bp, respectively. The reaction mix with
two pair primers (UL54F-UL54R, UL27F-UL27R) and the
PCR program used were the same as described above.

Aliquots (25 ul) of the PCR products were incubated with
BstEH, while the remaining 25 ul were used as undigested
control. The resulting products were separated by electro-
phoresis in 1% agarose gels and visualized under UV light

Maidana et ah BMC Veterinary Research 2013, 9:1 1 1
http://www.biomedcentral.eom/1746-6148/9/1 1 1

Page 6 of 7

after ethidium bromide staining. The pattern of expected
products before and after digestion is shown in Figure 3.

The applicability of multiplex PCR-REA was demon-
strated on reference strains corresponding to the 3 different
subtypes of each BoHV-5 as well as on 17 previously char-
acterized BoHV-5 fields isolates [11].

Sensitivity of the test

To evaluate the sensitivity of the multiplex PCR, 10-fold
serial dilutions of DNA obtained from different types of
samples (purified virus and infected tissue homogenates)
were used as template. Then copy numbers were calcu-
lated based on mass estimations of the entire genome of
BoHV-5 mass and of the DNA samples analyzed.

Competing interests

The authors declare that there are no competing interests.
Authors' contributions

SM and SR designed the experiments, analyzed the data and drafted the
manuscript together. SM performed the experiments. FC, PR and BS kindly
provided the reference strains. ET and AM participated in the interpretation
of data and preparation of the manuscript draft. CM, DC and GD helped
with virus amplification on cell cultures. All authors read and approved the
final manuscript.

Acknowledgments

The authors wish to thank Monica Florin-Christensen (1NTA) and Maria Isabel
Craig (INTA) for revising the manuscript and Matias Ottaviani for help in the
figures design. This work was supported by Fonds de la Recherche Scientifique
(FRS-FNRS, Belgium) and CONICET (Argentina). SM is a CONICET fellow.
'Etienne Thiry and Sonia Alejandra Romera are co-last authors.

Author details

'instituto de Virologia, Centra de Investigaciones en Ciencias Veterinarias y,
Agronomicas (CICVyA), Instituto de tecnologia Agropecuaria (INTA), N.
Repetto, y Los Reseros S/N, CC25, (B1712WAA), Castelar, Buenos Aires,
Argentina. 2 Consejo Nacional de Investigaciones, Cientificas y Tecnologicas
(CONICET), Rivadavia 1917, (C1033AAJ), Ciudad Autonoma de Buenos Aires,
Argentina. 3 lnmunologfa, Universidad del Salvador, Champagnat 1599-Ruta
Panamericana-Km 54.5 Pilar, -B1630AHU-Provincia de Buenos Aires,
Argentina. 4 Tecnovax SA, Luis Viaie 2835, 1416, Ciudad Autonoma de Buenos
Aires, Argentina. 5 Virology Laboratory, Department of Microbiology,
Immunology and Parasitology, Institute of Basic Health Sciences, Federal
University of Rio Grande do Sul (UFRGS), Av. Sarmento Leite 500, Porto
Alegre 90050-170, Rio Grande do Sul (RS), Brazil. 6 Laborat6rio de
Bioprocessos, Universidade Federal de Pelotas, Rua Gomes Carneiro, 1,
96010-610, Pelotas, Brasil. 'Veterinary Virology and Animal Viral Diseases,
Department of Infectious and Parasitic Diseases Faculty of Veterinary
Medicine, University of Liege, Liege, Belgium.

Received: 21 January 2013 Accepted: 1 June 2013
Published: 4 June 2013

Reference

1 . Del Medico Zajac MP, Ladelfa MF, Kotsias F, Muylkens B, Thiry J, Thiry E,
Romera SA: Biology of bovine herpesvirus 5. Vet J 2010, 184:138-145.

2. Vogel FS, Caron L, Flores EF, Weiblen R, Winkelmann ER, Mayer SV, Bastos
RG: Distribution of bovine herpesvirus type 5 DNA in the central nervous
systems of latently, experimentally infected calves. J Clin Microbiol 2003,
41:4512-4520.

3. French EL: A specific virus encephalitis in calves: isolation and
characterization of the causal agent. Aust Vet J 1 962, 38:21 6-221 .

4. D'Offay JM, Mock RE, Fulton RW: Isolation and characterization of
encephalitic bovine herpesvirus type 1 isolates from cattle in North
America. Am J Vet Res 1993, 54:534-539.

5. Moretti B, Orfei Z, Mondino G, Persechino A: [Isolation of the Infectious
Bovine Rhinotracheitis (Ibr) Virus in Italy. (Preliminary Note). Nuovi Ann Ig
Microb 1964, 15:18-22.

6. Bartha A, Hajdu G, Aldasy P, Paczolay G: Occurrence of encephalitis caused
by infectious bovine rhinotracheitis virus in calves in hungary. Acta Vet
Acad SciHung 1969, 19:145-151.

7. Carrillo BJ, Ambrogi A, Schudel AA, Vazquez M, Dahme E, Pospischil A:
Meningoencephalitis caused by IBR virus in calves in Argentina. Zbl Vet
Med B J Vet Med 1 983, 30:327-332.

8. Weiblen R, De Barros CS, Canabarro TF, Flores IE: Bovine
meningoencephalitis from IBR virus. Vet Rec 1989, 124:666-667.

9. Roehe PM, Silva TC, Nardi NB, Oliveira LG, Rosa JCA: Differentiation
between viruses of infectious bovine rhinotracheitis (BHV-1) and bovine
encephalitis herpesvirus (BHV-5) with monoclonal antibodies. Pesq Vet
Bras 1997, 17:41-44.

10. Rissi DR, Pierezan F, Silva MS, Flores EF, De Barros CS: Neurological disease
in cattle in southern Brazil associated with Bovine herpesvirus infection.
J Vet Diagn Invest 2008, 20:346-349.

1 1 . Maidana SS, Ladelfa MF, Perez SE, Lomonaco PM, Del Medico Zajac MP,
Odeon A, Blanco Vera J, Combessies G, Fondevila N, Palacios M, et ah
Characterization of BoHV-5 field strains circulation and report of
transient specific subtype of bovine herpesvirus 5 in Argentina. BMC Vet
Res 2011, 7:8.

12. Thiry E, Muylkens B, Meurens F, Gogev S, Thiry J, Vanderplasschen A,
Schynts F: Recombination in the alphaherpesvirus bovine herpesvirus 1.
Vet Microbiol 2006, 1 1 3:1 71 -1 77.

13. Cascio KE, Belknap EB, Schultheiss PC, Ames AD, Collins JK: Encephalitis
induced by bovine herpesvirus 5 and protection by prior vaccination or
infection with bovine herpesvirus I.J Vet Diagn Invest 1999, 11:134-139.

14. Del Medico Zajac MP, Puntel M, Zamorano PI, Sadir AM, Romera SA: BHV-1
vaccine induces cross-protection against BHV-5 disease in cattle. Res Vet
Sci 2006, 81:327-334.

15. Ashbaugh SE, Thompson KE, Belknap EB, Schultheiss PC, Chowdhury S,
Collins JK: Specific detection of shedding and latency of bovine
herpesvirus 1 and 5 using a nested polymerase chain reaction. J Vet
Diagn Invest 1 997, 9:387-394.

1 6. Meyer G, Lemaire M, Ros C, Belak K, Gabriel A, Cassart D, Coignoul F, Belak S,
Thiry E: Comparative pathogenesis of acute and latent infections of calves
with bovine herpesvirus types 1 and 5. Arch Virol 2001, 146:633-652.

17. Diallo IS, Corney BG, Rodwell BJ: Detection and differentiation of bovine
herpesvirus 1 and 5 using a multiplex real-time polymerase chain
reaction. J Virol Methods 201 1, 175:46-52.

18. Oliveira MT, Campos FS, Dias MM, Velho FA, Freneau GE, Brito WM, Rijsewijk
FA, Franco AC, Roehe PM: Detection of bovine herpesvirus 1 and 5 in
semen from Brazilian bulls. Theriogenology 201 1, 75:1 139-1 145.

19. Metzler AE, Matile H, Gassmann U, Engels M, Wyler R: European isolates of
bovine herpesvirus 1: a comparison of restriction endonuclease sites,
polypeptides, and reactivity with monoclonal antibodies. Arch Virol
1985, 85:57-69.

20. Keuser V, Schynts F, Detry B, Collard A, Robert B, Vanderplasschen A,
Pastoret PP, Thiry E: Improved antigenic methods for differential
diagnosis of bovine, caprine, and cervine alphaherpesviruses related to
bovine herpesvirus 1 . J Clin Microbiol 2004, 42:1 228-1 235.

21 . Thiry J, Tempesta M, Camera M, Tarsitano E, Muylkens B, Meurens F, Thiry E,
Buonavoglia C: Clinical protection against caprine herpesvirus 1 genital
infection by intranasal administration of a live attenuated glycoprotein E
negative bovine herpesvirus 1 vaccine. BMC Vet Res 2007, 3:33.

22. Ros C, Belak S: Studies of genetic relationships between bovine, caprine,
cervine, and rangiferine alphaherpesviruses and improved molecular
methods for virus detection and identification. J Clin Microbiol

1999, 37:1247-1253.

23. Alegre M, Nanni M, Fondevila N: Development of a multiplex polymerase
chain reaction for the differentiation of bovine herpesvirus-1 and -5.

J Vet Med 2001, 48:613-621.

24. Claus MP, Alfieri AF, Folgueras-Flatschart AV, Wosiacki SR, Medici KC, Alfieri
AA: Rapid detection and differentiation of bovine herpesvirus 1 and 5
glycoprotein C gene in clinical specimens by multiplex-PCR. J Virol
Methods 2005, 128:183-188.

25. Thiry J, Widen F, Gregoire F, Linden A, Belak S, Thiry E: Isolation and
characterisation of a ruminant alphaherpesvirus closely related to
bovine herpesvirus 1 in a free-ranging red deer. BMC Vet Res 2007, 3:26.

Maidana et al. BMC Veterinary Research 2013, 9:1 1 1
http://www.biomedcentral.eom/1746-6148/9/1 1 1

Page 7 of 7

26. Afonso DA, Ortega LS, Redondo RA, Trindade Gde S, Barbosa-Stancioli EF:
Characterization of field bovine herpesvirus samples using random
amplified polymorphic DNA (RAPD). J Virol Methods 2007, 140:200-205.

27. Del Medico Zajac MP, Romera SA, Ladelfa MF, Kotsias F, Thiry J, Ziant D,
Meurens F, Keil GM, Thiry E, Muylkens B: Characterization of interspecific
recombinants generated from closely related bovine herpesviruses 1 and 5
through multiple PCR sequencing assays. J Virol Methods 2009, 161:75-83.

28. Brake F, Studdert MJ: Molecular epidemiology and pathogenesis of
ruminant herpesviruses including bovine, buffalo and caprine
herpesviruses I and bovine encephalitis herpesvirus. Aust Vet J 1985,
62:331-334.

29. D'Arce RC, Almeida RS, Silva TC, Franco AC, Spilki F, Roehe PM, Arns CW:
Restriction endonuclease and monoclonal antibody analysis of Brazilian
isolates of bovine herpesviruses types 1 and 5. Vet Microbiol 2002,
88:315-324.

30. Ladelfa MF, Del Medico Zajac MP, Kotsias F, Delgado F, Muylkens B, Thiry J,
Thiry E, Romera SA: Comparative study on the in vitro and in vivo
properties of two bovine herpesvirus-5 reference strains. Acta Vet Scand
2011, 53:37.

31. Hall TA: BioEdit: a user-friendly biological sequence alignment editor and
analysis program for Windows 95/98/NT. Nud Acids Symp Ser 1999, 41:95-98.

' >

doi:l 0.1 1 86/1 746-61 48-9-1 1 1

Cite this article as: Maidana et al:. Multiplex PCR followed by restriction
length polymorphism analysis for the subtyping of bovine herpesvirus 5
isolates. BMC Veterinary Research 2013 9:1 1 1.

Submit your next manuscript to BioMed Central
and take full advantage of:

• Convenient online submission

• Thorough peer review

• No space constraints or color figure charges

• Immediate publication on acceptance

• Inclusion in PubMed, CAS, Scopus and Google Scholar

• Research which is freely available for redistribution

Submit your manuscript at /^'\ n! _, ul _-| r Q r,tr=l

www.biomedcentral.com/submit ammBa central

V